Review



mtor shrna plasmid addgene  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98

    Structured Review

    Addgene inc mtor shrna plasmid addgene
    Figure 1. RIME identification of <t>mTOR</t> CIPs in PCa cells (A) Schematic of mTOR RIME analysis in four PCa models treated with vehicle (DMSO), the synthetic androgen R1881, and/or mTOR inhibitor Torin 1 in biological triplicates. Vehicle-treated immunoglobulin G controls were also used. (B) mTOR protein structure and cumulative peptide coverage from mTOR RIME analysis across triplicate experiments in four PCa cell lines. (C) Total mTOR RIME CIPs identified and whether they were previously known. (D) Immunoblot analysis of mTOR, AR full-length (AR-FL) and splice variant (AR-V7), and PTEN levels in nuclear PCa homogenates. Lamin B1 levels are shown as a loading control. (E) Overlap of mTOR RIME datasets between PCa cell lines/conditions. See also Figure S1.
    Mtor Shrna Plasmid Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 14751 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mtor+shrna+plasmid+addgene/pMD2%2EG+(Plasmid+%2312259)/pm35320709-234-76-79
    Average 98 stars, based on 14751 article reviews
    mtor shrna plasmid addgene - by Bioz Stars, 2026-09
    98/100 stars

    Images

    1) Product Images from "The mTOR chromatin-bound interactome in prostate cancer."

    Article Title: The mTOR chromatin-bound interactome in prostate cancer.

    Journal: Cell reports

    doi: 10.1016/j.celrep.2022.110534

    Figure 1. RIME identification of mTOR CIPs in PCa cells (A) Schematic of mTOR RIME analysis in four PCa models treated with vehicle (DMSO), the synthetic androgen R1881, and/or mTOR inhibitor Torin 1 in biological triplicates. Vehicle-treated immunoglobulin G controls were also used. (B) mTOR protein structure and cumulative peptide coverage from mTOR RIME analysis across triplicate experiments in four PCa cell lines. (C) Total mTOR RIME CIPs identified and whether they were previously known. (D) Immunoblot analysis of mTOR, AR full-length (AR-FL) and splice variant (AR-V7), and PTEN levels in nuclear PCa homogenates. Lamin B1 levels are shown as a loading control. (E) Overlap of mTOR RIME datasets between PCa cell lines/conditions. See also Figure S1.
    Figure Legend Snippet: Figure 1. RIME identification of mTOR CIPs in PCa cells (A) Schematic of mTOR RIME analysis in four PCa models treated with vehicle (DMSO), the synthetic androgen R1881, and/or mTOR inhibitor Torin 1 in biological triplicates. Vehicle-treated immunoglobulin G controls were also used. (B) mTOR protein structure and cumulative peptide coverage from mTOR RIME analysis across triplicate experiments in four PCa cell lines. (C) Total mTOR RIME CIPs identified and whether they were previously known. (D) Immunoblot analysis of mTOR, AR full-length (AR-FL) and splice variant (AR-V7), and PTEN levels in nuclear PCa homogenates. Lamin B1 levels are shown as a loading control. (E) Overlap of mTOR RIME datasets between PCa cell lines/conditions. See also Figure S1.

    Techniques Used: Western Blot, Variant Assay, Control

    Figure 2. Effect of R1881 and/or Torin 1 on chromatin mTOR-protein interactions (A) Overlap of drug-modulated mTOR CIPs from triplicate RIME experiments in AR+ LNCaP and 22Rv1 cells. (B) R1881-modulated chromatin-bound mTOR-protein affinities. Gene names for a subset of the CIPs are shown. Red, enhanced/gained interactions; blue, reduced/lost interactions. (C) AR protein structure and cumulative peptide coverage from mTOR RIME analysis across triplicate experiments in AR+ cells.
    Figure Legend Snippet: Figure 2. Effect of R1881 and/or Torin 1 on chromatin mTOR-protein interactions (A) Overlap of drug-modulated mTOR CIPs from triplicate RIME experiments in AR+ LNCaP and 22Rv1 cells. (B) R1881-modulated chromatin-bound mTOR-protein affinities. Gene names for a subset of the CIPs are shown. Red, enhanced/gained interactions; blue, reduced/lost interactions. (C) AR protein structure and cumulative peptide coverage from mTOR RIME analysis across triplicate experiments in AR+ cells.

    Techniques Used:

    Figure 3. Functional enrichment analysis of mTOR CIPs in LNCaP cells ± R1881 (A) Venn diagrams showing the number of mTOR CIPs identified in LNCaP cells from biological triplicates under vehicle or R1881 conditions versus immuno- globulin G control with 87% of the total having a known nuclear localization.
    Figure Legend Snippet: Figure 3. Functional enrichment analysis of mTOR CIPs in LNCaP cells ± R1881 (A) Venn diagrams showing the number of mTOR CIPs identified in LNCaP cells from biological triplicates under vehicle or R1881 conditions versus immuno- globulin G control with 87% of the total having a known nuclear localization.

    Techniques Used: Functional Assay, Control

    Figure 4. Identification of a conserved mTOR chromatin network in PCa cells (A) Left, common significantly over-represented Ingenuity Pathway Analysis (IPA) canonical pathways from mTOR RIME analysis in four PCa cell lines under basal conditions (vehicle-treated) performed in biological triplicates. Right, mTOR RIME associations with NuRD complex components. (B) Chow-Ruskey Venn diagram of mTOR RIME datasets from four PCa cell lines in the basal state (vehicle-treated) shows a conserved set of 67 mTOR CIPs. (C) Basic functional annotation of the conserved mTOR 67-CIP hub identified in (B). (D) Metascape interactome network of the conserved mTOR 67-CIP set identified in (B) along with four extracted MCODE subcomplexes and their associated biological functions. Larger node size reflects increased protein interconnectivity. (E) Ranked normalized TPIs of identified mTOR RIME CIPs in four PCa cell lines from triplicate experiments of vehicle-treated versus immunoglobulin G control showing SUMO2 and SUMO3 as top conserved hits. See also Figures S3 and S4.
    Figure Legend Snippet: Figure 4. Identification of a conserved mTOR chromatin network in PCa cells (A) Left, common significantly over-represented Ingenuity Pathway Analysis (IPA) canonical pathways from mTOR RIME analysis in four PCa cell lines under basal conditions (vehicle-treated) performed in biological triplicates. Right, mTOR RIME associations with NuRD complex components. (B) Chow-Ruskey Venn diagram of mTOR RIME datasets from four PCa cell lines in the basal state (vehicle-treated) shows a conserved set of 67 mTOR CIPs. (C) Basic functional annotation of the conserved mTOR 67-CIP hub identified in (B). (D) Metascape interactome network of the conserved mTOR 67-CIP set identified in (B) along with four extracted MCODE subcomplexes and their associated biological functions. Larger node size reflects increased protein interconnectivity. (E) Ranked normalized TPIs of identified mTOR RIME CIPs in four PCa cell lines from triplicate experiments of vehicle-treated versus immunoglobulin G control showing SUMO2 and SUMO3 as top conserved hits. See also Figures S3 and S4.

    Techniques Used: Functional Assay, Control

    Figure 7. Androgens promote assembly of an mTOR-AR-HDAC2 transcriptional complex (A) Co-IP experiments in LNCaP cells show that mTOR and AR interact with NuRD complex components. (B) R1881 increases the overlap of mTOR, AR, and HDAC2 ChIP-seq peaks in PCa cells. (C) Genome-wide mapping of mTOR-AR-HDAC2 co-occupied sites between vehicle (EtOH)- and R1881-treated PCa cells. (D) Pie charts showing that most of the mTOR-AR-HDAC2 peaks found within ±20 kb of ARG TSSs are up-regulated by androgens. (E) Genome browser views showing R1881-mediated de novo formation of an mTOR-AR-HDAC2 complex at ARGs in PCa cells. (F) Heatmaps of ChIP-qPCR enrichment values in LNCaP cells showing the temporal R1881-mediated co-recruitment of mTOR, AR, NuRD-associated HDAC2 and CHD4, RNA polymerase II, and deposition of the active histone mark H3K27ac at mTOR-AR-HDAC2-targeted ARGs shown in (E). (G) Immunoblots showing efficacy of shRNA-mediated silencing of HDAC2 in LNCaP cells. Lamin B1 levels are shown as a loading control.
    Figure Legend Snippet: Figure 7. Androgens promote assembly of an mTOR-AR-HDAC2 transcriptional complex (A) Co-IP experiments in LNCaP cells show that mTOR and AR interact with NuRD complex components. (B) R1881 increases the overlap of mTOR, AR, and HDAC2 ChIP-seq peaks in PCa cells. (C) Genome-wide mapping of mTOR-AR-HDAC2 co-occupied sites between vehicle (EtOH)- and R1881-treated PCa cells. (D) Pie charts showing that most of the mTOR-AR-HDAC2 peaks found within ±20 kb of ARG TSSs are up-regulated by androgens. (E) Genome browser views showing R1881-mediated de novo formation of an mTOR-AR-HDAC2 complex at ARGs in PCa cells. (F) Heatmaps of ChIP-qPCR enrichment values in LNCaP cells showing the temporal R1881-mediated co-recruitment of mTOR, AR, NuRD-associated HDAC2 and CHD4, RNA polymerase II, and deposition of the active histone mark H3K27ac at mTOR-AR-HDAC2-targeted ARGs shown in (E). (G) Immunoblots showing efficacy of shRNA-mediated silencing of HDAC2 in LNCaP cells. Lamin B1 levels are shown as a loading control.

    Techniques Used: Co-Immunoprecipitation Assay, ChIP-sequencing, Genome Wide, ChIP-qPCR, Western Blot, shRNA, Control

    Related Articles

    Control:

    Article Title: The mTOR chromatin-bound interactome in prostate cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER ON-TARGETplus SMARTpool non-targeting control siRNAs Dharmacon (Horizon Discovery) Cat# D-001810-10-20 Human shHDAC2#1: CAGTCTCACCAATTT CAGAAA Sigma-Aldrich Cat # TRCN0000004819 Human shHDAC2#2: GCCTATTATCTCAAA GGTGAT Sigma-Aldrich Cat# TRCN0000004821 Human gene-specific primers for qRT-PCR analysis This paper Table S7 Human gene-specific primers for ChIP-qPCR analysis This paper Table S7 Recombinant DNA ViraPowerTM Lentiviral Packaging Mix Thermo Fisher Scientific Cat# K4975-00 Lentiviral packaging plasmid psPAX2 addgene Cat# 12260 VSV-G envelope expressing plasmid pMD2.G addgene Cat# 12259 mTOR shRNA plasmid addgene Cat# 1856 Software and algorithms Proteome Discoverer v2.3 Thermo Scientific Cat# OPTON-20141 Mascot v2.6 Matrix Science http://www.matrixscience.com/ Scaffold v4.10.0 Proteome Software https://www.proteomesoftware.com/ Phantasus v1.11.0 Bioconductor (https://doi.org/ 10.18129/B9.bioc.phantasus) https://genome.ifmo.ru/phantasus ExPASy PeptideCutter Duvaud et al., 2021 https://web.expasy.org/peptide_cutter/ WebGestalt Liao et al., 2019 RRID:SCR_006786 Ingenuity Pathway Analysis (IPA) QIAGEN RRID:SCR_008653 Metascape Zhou et al., 2019 RRID:SCR_016620 Intervene Khan and Mathelier, 2017 https://asntech.shinyapps.io/intervene/ ChIP-Atlas Oki et al., 2018 RRID:SCR_015511 HOMER v4.11 Heinz et al., 2010 RRID:SCR_010881 BioGRID v3.5 Oughtred et al., 2019 RRID:SCR_007393 STRING v11.0 Szklarczyk et al., 2019 RRID:SCR_005223 HuRI Luck et al., 2020 RRID:SCR_015670 IID Kotlyar et al., 2016 http://ophid.utoronto.ca/iid Morpheus Broad Institute RRID:SCR_017386 Cancer Dependency Map (DepMap) portal Broad Institute RRID:SCR_017655 Prism v9 GraphPad https://www.graphpad.com/ scientific-software/prism/ Other Easy-nLC II system Thermo Fisher Scientific (Proxeon Biosystems) https://www.thermofisher.com/ LTQ Orbitrap Velos spectrometer Thermo Fisher Scientific https://www.thermofisher.com/ ChemiDoc MP imaging system Bio-Rad Cat# 12003154 LightCycler 480 system Roche https://diagnostics.roche.com/ global/en/products/systems/lightcycler480-system.html ..

    Quantitative RT-PCR:

    Article Title: The mTOR chromatin-bound interactome in prostate cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER ON-TARGETplus SMARTpool non-targeting control siRNAs Dharmacon (Horizon Discovery) Cat# D-001810-10-20 Human shHDAC2#1: CAGTCTCACCAATTT CAGAAA Sigma-Aldrich Cat # TRCN0000004819 Human shHDAC2#2: GCCTATTATCTCAAA GGTGAT Sigma-Aldrich Cat# TRCN0000004821 Human gene-specific primers for qRT-PCR analysis This paper Table S7 Human gene-specific primers for ChIP-qPCR analysis This paper Table S7 Recombinant DNA ViraPowerTM Lentiviral Packaging Mix Thermo Fisher Scientific Cat# K4975-00 Lentiviral packaging plasmid psPAX2 addgene Cat# 12260 VSV-G envelope expressing plasmid pMD2.G addgene Cat# 12259 mTOR shRNA plasmid addgene Cat# 1856 Software and algorithms Proteome Discoverer v2.3 Thermo Scientific Cat# OPTON-20141 Mascot v2.6 Matrix Science http://www.matrixscience.com/ Scaffold v4.10.0 Proteome Software https://www.proteomesoftware.com/ Phantasus v1.11.0 Bioconductor (https://doi.org/ 10.18129/B9.bioc.phantasus) https://genome.ifmo.ru/phantasus ExPASy PeptideCutter Duvaud et al., 2021 https://web.expasy.org/peptide_cutter/ WebGestalt Liao et al., 2019 RRID:SCR_006786 Ingenuity Pathway Analysis (IPA) QIAGEN RRID:SCR_008653 Metascape Zhou et al., 2019 RRID:SCR_016620 Intervene Khan and Mathelier, 2017 https://asntech.shinyapps.io/intervene/ ChIP-Atlas Oki et al., 2018 RRID:SCR_015511 HOMER v4.11 Heinz et al., 2010 RRID:SCR_010881 BioGRID v3.5 Oughtred et al., 2019 RRID:SCR_007393 STRING v11.0 Szklarczyk et al., 2019 RRID:SCR_005223 HuRI Luck et al., 2020 RRID:SCR_015670 IID Kotlyar et al., 2016 http://ophid.utoronto.ca/iid Morpheus Broad Institute RRID:SCR_017386 Cancer Dependency Map (DepMap) portal Broad Institute RRID:SCR_017655 Prism v9 GraphPad https://www.graphpad.com/ scientific-software/prism/ Other Easy-nLC II system Thermo Fisher Scientific (Proxeon Biosystems) https://www.thermofisher.com/ LTQ Orbitrap Velos spectrometer Thermo Fisher Scientific https://www.thermofisher.com/ ChemiDoc MP imaging system Bio-Rad Cat# 12003154 LightCycler 480 system Roche https://diagnostics.roche.com/ global/en/products/systems/lightcycler480-system.html ..

    ChIP-qPCR:

    Article Title: The mTOR chromatin-bound interactome in prostate cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER ON-TARGETplus SMARTpool non-targeting control siRNAs Dharmacon (Horizon Discovery) Cat# D-001810-10-20 Human shHDAC2#1: CAGTCTCACCAATTT CAGAAA Sigma-Aldrich Cat # TRCN0000004819 Human shHDAC2#2: GCCTATTATCTCAAA GGTGAT Sigma-Aldrich Cat# TRCN0000004821 Human gene-specific primers for qRT-PCR analysis This paper Table S7 Human gene-specific primers for ChIP-qPCR analysis This paper Table S7 Recombinant DNA ViraPowerTM Lentiviral Packaging Mix Thermo Fisher Scientific Cat# K4975-00 Lentiviral packaging plasmid psPAX2 addgene Cat# 12260 VSV-G envelope expressing plasmid pMD2.G addgene Cat# 12259 mTOR shRNA plasmid addgene Cat# 1856 Software and algorithms Proteome Discoverer v2.3 Thermo Scientific Cat# OPTON-20141 Mascot v2.6 Matrix Science http://www.matrixscience.com/ Scaffold v4.10.0 Proteome Software https://www.proteomesoftware.com/ Phantasus v1.11.0 Bioconductor (https://doi.org/ 10.18129/B9.bioc.phantasus) https://genome.ifmo.ru/phantasus ExPASy PeptideCutter Duvaud et al., 2021 https://web.expasy.org/peptide_cutter/ WebGestalt Liao et al., 2019 RRID:SCR_006786 Ingenuity Pathway Analysis (IPA) QIAGEN RRID:SCR_008653 Metascape Zhou et al., 2019 RRID:SCR_016620 Intervene Khan and Mathelier, 2017 https://asntech.shinyapps.io/intervene/ ChIP-Atlas Oki et al., 2018 RRID:SCR_015511 HOMER v4.11 Heinz et al., 2010 RRID:SCR_010881 BioGRID v3.5 Oughtred et al., 2019 RRID:SCR_007393 STRING v11.0 Szklarczyk et al., 2019 RRID:SCR_005223 HuRI Luck et al., 2020 RRID:SCR_015670 IID Kotlyar et al., 2016 http://ophid.utoronto.ca/iid Morpheus Broad Institute RRID:SCR_017386 Cancer Dependency Map (DepMap) portal Broad Institute RRID:SCR_017655 Prism v9 GraphPad https://www.graphpad.com/ scientific-software/prism/ Other Easy-nLC II system Thermo Fisher Scientific (Proxeon Biosystems) https://www.thermofisher.com/ LTQ Orbitrap Velos spectrometer Thermo Fisher Scientific https://www.thermofisher.com/ ChemiDoc MP imaging system Bio-Rad Cat# 12003154 LightCycler 480 system Roche https://diagnostics.roche.com/ global/en/products/systems/lightcycler480-system.html ..

    Recombinant:

    Article Title: The mTOR chromatin-bound interactome in prostate cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER ON-TARGETplus SMARTpool non-targeting control siRNAs Dharmacon (Horizon Discovery) Cat# D-001810-10-20 Human shHDAC2#1: CAGTCTCACCAATTT CAGAAA Sigma-Aldrich Cat # TRCN0000004819 Human shHDAC2#2: GCCTATTATCTCAAA GGTGAT Sigma-Aldrich Cat# TRCN0000004821 Human gene-specific primers for qRT-PCR analysis This paper Table S7 Human gene-specific primers for ChIP-qPCR analysis This paper Table S7 Recombinant DNA ViraPowerTM Lentiviral Packaging Mix Thermo Fisher Scientific Cat# K4975-00 Lentiviral packaging plasmid psPAX2 addgene Cat# 12260 VSV-G envelope expressing plasmid pMD2.G addgene Cat# 12259 mTOR shRNA plasmid addgene Cat# 1856 Software and algorithms Proteome Discoverer v2.3 Thermo Scientific Cat# OPTON-20141 Mascot v2.6 Matrix Science http://www.matrixscience.com/ Scaffold v4.10.0 Proteome Software https://www.proteomesoftware.com/ Phantasus v1.11.0 Bioconductor (https://doi.org/ 10.18129/B9.bioc.phantasus) https://genome.ifmo.ru/phantasus ExPASy PeptideCutter Duvaud et al., 2021 https://web.expasy.org/peptide_cutter/ WebGestalt Liao et al., 2019 RRID:SCR_006786 Ingenuity Pathway Analysis (IPA) QIAGEN RRID:SCR_008653 Metascape Zhou et al., 2019 RRID:SCR_016620 Intervene Khan and Mathelier, 2017 https://asntech.shinyapps.io/intervene/ ChIP-Atlas Oki et al., 2018 RRID:SCR_015511 HOMER v4.11 Heinz et al., 2010 RRID:SCR_010881 BioGRID v3.5 Oughtred et al., 2019 RRID:SCR_007393 STRING v11.0 Szklarczyk et al., 2019 RRID:SCR_005223 HuRI Luck et al., 2020 RRID:SCR_015670 IID Kotlyar et al., 2016 http://ophid.utoronto.ca/iid Morpheus Broad Institute RRID:SCR_017386 Cancer Dependency Map (DepMap) portal Broad Institute RRID:SCR_017655 Prism v9 GraphPad https://www.graphpad.com/ scientific-software/prism/ Other Easy-nLC II system Thermo Fisher Scientific (Proxeon Biosystems) https://www.thermofisher.com/ LTQ Orbitrap Velos spectrometer Thermo Fisher Scientific https://www.thermofisher.com/ ChemiDoc MP imaging system Bio-Rad Cat# 12003154 LightCycler 480 system Roche https://diagnostics.roche.com/ global/en/products/systems/lightcycler480-system.html ..

    Plasmid Preparation:

    Article Title: The mTOR chromatin-bound interactome in prostate cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER ON-TARGETplus SMARTpool non-targeting control siRNAs Dharmacon (Horizon Discovery) Cat# D-001810-10-20 Human shHDAC2#1: CAGTCTCACCAATTT CAGAAA Sigma-Aldrich Cat # TRCN0000004819 Human shHDAC2#2: GCCTATTATCTCAAA GGTGAT Sigma-Aldrich Cat# TRCN0000004821 Human gene-specific primers for qRT-PCR analysis This paper Table S7 Human gene-specific primers for ChIP-qPCR analysis This paper Table S7 Recombinant DNA ViraPowerTM Lentiviral Packaging Mix Thermo Fisher Scientific Cat# K4975-00 Lentiviral packaging plasmid psPAX2 addgene Cat# 12260 VSV-G envelope expressing plasmid pMD2.G addgene Cat# 12259 mTOR shRNA plasmid addgene Cat# 1856 Software and algorithms Proteome Discoverer v2.3 Thermo Scientific Cat# OPTON-20141 Mascot v2.6 Matrix Science http://www.matrixscience.com/ Scaffold v4.10.0 Proteome Software https://www.proteomesoftware.com/ Phantasus v1.11.0 Bioconductor (https://doi.org/ 10.18129/B9.bioc.phantasus) https://genome.ifmo.ru/phantasus ExPASy PeptideCutter Duvaud et al., 2021 https://web.expasy.org/peptide_cutter/ WebGestalt Liao et al., 2019 RRID:SCR_006786 Ingenuity Pathway Analysis (IPA) QIAGEN RRID:SCR_008653 Metascape Zhou et al., 2019 RRID:SCR_016620 Intervene Khan and Mathelier, 2017 https://asntech.shinyapps.io/intervene/ ChIP-Atlas Oki et al., 2018 RRID:SCR_015511 HOMER v4.11 Heinz et al., 2010 RRID:SCR_010881 BioGRID v3.5 Oughtred et al., 2019 RRID:SCR_007393 STRING v11.0 Szklarczyk et al., 2019 RRID:SCR_005223 HuRI Luck et al., 2020 RRID:SCR_015670 IID Kotlyar et al., 2016 http://ophid.utoronto.ca/iid Morpheus Broad Institute RRID:SCR_017386 Cancer Dependency Map (DepMap) portal Broad Institute RRID:SCR_017655 Prism v9 GraphPad https://www.graphpad.com/ scientific-software/prism/ Other Easy-nLC II system Thermo Fisher Scientific (Proxeon Biosystems) https://www.thermofisher.com/ LTQ Orbitrap Velos spectrometer Thermo Fisher Scientific https://www.thermofisher.com/ ChemiDoc MP imaging system Bio-Rad Cat# 12003154 LightCycler 480 system Roche https://diagnostics.roche.com/ global/en/products/systems/lightcycler480-system.html ..

    Expressing:

    Article Title: The mTOR chromatin-bound interactome in prostate cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER ON-TARGETplus SMARTpool non-targeting control siRNAs Dharmacon (Horizon Discovery) Cat# D-001810-10-20 Human shHDAC2#1: CAGTCTCACCAATTT CAGAAA Sigma-Aldrich Cat # TRCN0000004819 Human shHDAC2#2: GCCTATTATCTCAAA GGTGAT Sigma-Aldrich Cat# TRCN0000004821 Human gene-specific primers for qRT-PCR analysis This paper Table S7 Human gene-specific primers for ChIP-qPCR analysis This paper Table S7 Recombinant DNA ViraPowerTM Lentiviral Packaging Mix Thermo Fisher Scientific Cat# K4975-00 Lentiviral packaging plasmid psPAX2 addgene Cat# 12260 VSV-G envelope expressing plasmid pMD2.G addgene Cat# 12259 mTOR shRNA plasmid addgene Cat# 1856 Software and algorithms Proteome Discoverer v2.3 Thermo Scientific Cat# OPTON-20141 Mascot v2.6 Matrix Science http://www.matrixscience.com/ Scaffold v4.10.0 Proteome Software https://www.proteomesoftware.com/ Phantasus v1.11.0 Bioconductor (https://doi.org/ 10.18129/B9.bioc.phantasus) https://genome.ifmo.ru/phantasus ExPASy PeptideCutter Duvaud et al., 2021 https://web.expasy.org/peptide_cutter/ WebGestalt Liao et al., 2019 RRID:SCR_006786 Ingenuity Pathway Analysis (IPA) QIAGEN RRID:SCR_008653 Metascape Zhou et al., 2019 RRID:SCR_016620 Intervene Khan and Mathelier, 2017 https://asntech.shinyapps.io/intervene/ ChIP-Atlas Oki et al., 2018 RRID:SCR_015511 HOMER v4.11 Heinz et al., 2010 RRID:SCR_010881 BioGRID v3.5 Oughtred et al., 2019 RRID:SCR_007393 STRING v11.0 Szklarczyk et al., 2019 RRID:SCR_005223 HuRI Luck et al., 2020 RRID:SCR_015670 IID Kotlyar et al., 2016 http://ophid.utoronto.ca/iid Morpheus Broad Institute RRID:SCR_017386 Cancer Dependency Map (DepMap) portal Broad Institute RRID:SCR_017655 Prism v9 GraphPad https://www.graphpad.com/ scientific-software/prism/ Other Easy-nLC II system Thermo Fisher Scientific (Proxeon Biosystems) https://www.thermofisher.com/ LTQ Orbitrap Velos spectrometer Thermo Fisher Scientific https://www.thermofisher.com/ ChemiDoc MP imaging system Bio-Rad Cat# 12003154 LightCycler 480 system Roche https://diagnostics.roche.com/ global/en/products/systems/lightcycler480-system.html ..

    shRNA:

    Article Title: The mTOR chromatin-bound interactome in prostate cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER ON-TARGETplus SMARTpool non-targeting control siRNAs Dharmacon (Horizon Discovery) Cat# D-001810-10-20 Human shHDAC2#1: CAGTCTCACCAATTT CAGAAA Sigma-Aldrich Cat # TRCN0000004819 Human shHDAC2#2: GCCTATTATCTCAAA GGTGAT Sigma-Aldrich Cat# TRCN0000004821 Human gene-specific primers for qRT-PCR analysis This paper Table S7 Human gene-specific primers for ChIP-qPCR analysis This paper Table S7 Recombinant DNA ViraPowerTM Lentiviral Packaging Mix Thermo Fisher Scientific Cat# K4975-00 Lentiviral packaging plasmid psPAX2 addgene Cat# 12260 VSV-G envelope expressing plasmid pMD2.G addgene Cat# 12259 mTOR shRNA plasmid addgene Cat# 1856 Software and algorithms Proteome Discoverer v2.3 Thermo Scientific Cat# OPTON-20141 Mascot v2.6 Matrix Science http://www.matrixscience.com/ Scaffold v4.10.0 Proteome Software https://www.proteomesoftware.com/ Phantasus v1.11.0 Bioconductor (https://doi.org/ 10.18129/B9.bioc.phantasus) https://genome.ifmo.ru/phantasus ExPASy PeptideCutter Duvaud et al., 2021 https://web.expasy.org/peptide_cutter/ WebGestalt Liao et al., 2019 RRID:SCR_006786 Ingenuity Pathway Analysis (IPA) QIAGEN RRID:SCR_008653 Metascape Zhou et al., 2019 RRID:SCR_016620 Intervene Khan and Mathelier, 2017 https://asntech.shinyapps.io/intervene/ ChIP-Atlas Oki et al., 2018 RRID:SCR_015511 HOMER v4.11 Heinz et al., 2010 RRID:SCR_010881 BioGRID v3.5 Oughtred et al., 2019 RRID:SCR_007393 STRING v11.0 Szklarczyk et al., 2019 RRID:SCR_005223 HuRI Luck et al., 2020 RRID:SCR_015670 IID Kotlyar et al., 2016 http://ophid.utoronto.ca/iid Morpheus Broad Institute RRID:SCR_017386 Cancer Dependency Map (DepMap) portal Broad Institute RRID:SCR_017655 Prism v9 GraphPad https://www.graphpad.com/ scientific-software/prism/ Other Easy-nLC II system Thermo Fisher Scientific (Proxeon Biosystems) https://www.thermofisher.com/ LTQ Orbitrap Velos spectrometer Thermo Fisher Scientific https://www.thermofisher.com/ ChemiDoc MP imaging system Bio-Rad Cat# 12003154 LightCycler 480 system Roche https://diagnostics.roche.com/ global/en/products/systems/lightcycler480-system.html ..

    Software:

    Article Title: The mTOR chromatin-bound interactome in prostate cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER ON-TARGETplus SMARTpool non-targeting control siRNAs Dharmacon (Horizon Discovery) Cat# D-001810-10-20 Human shHDAC2#1: CAGTCTCACCAATTT CAGAAA Sigma-Aldrich Cat # TRCN0000004819 Human shHDAC2#2: GCCTATTATCTCAAA GGTGAT Sigma-Aldrich Cat# TRCN0000004821 Human gene-specific primers for qRT-PCR analysis This paper Table S7 Human gene-specific primers for ChIP-qPCR analysis This paper Table S7 Recombinant DNA ViraPowerTM Lentiviral Packaging Mix Thermo Fisher Scientific Cat# K4975-00 Lentiviral packaging plasmid psPAX2 addgene Cat# 12260 VSV-G envelope expressing plasmid pMD2.G addgene Cat# 12259 mTOR shRNA plasmid addgene Cat# 1856 Software and algorithms Proteome Discoverer v2.3 Thermo Scientific Cat# OPTON-20141 Mascot v2.6 Matrix Science http://www.matrixscience.com/ Scaffold v4.10.0 Proteome Software https://www.proteomesoftware.com/ Phantasus v1.11.0 Bioconductor (https://doi.org/ 10.18129/B9.bioc.phantasus) https://genome.ifmo.ru/phantasus ExPASy PeptideCutter Duvaud et al., 2021 https://web.expasy.org/peptide_cutter/ WebGestalt Liao et al., 2019 RRID:SCR_006786 Ingenuity Pathway Analysis (IPA) QIAGEN RRID:SCR_008653 Metascape Zhou et al., 2019 RRID:SCR_016620 Intervene Khan and Mathelier, 2017 https://asntech.shinyapps.io/intervene/ ChIP-Atlas Oki et al., 2018 RRID:SCR_015511 HOMER v4.11 Heinz et al., 2010 RRID:SCR_010881 BioGRID v3.5 Oughtred et al., 2019 RRID:SCR_007393 STRING v11.0 Szklarczyk et al., 2019 RRID:SCR_005223 HuRI Luck et al., 2020 RRID:SCR_015670 IID Kotlyar et al., 2016 http://ophid.utoronto.ca/iid Morpheus Broad Institute RRID:SCR_017386 Cancer Dependency Map (DepMap) portal Broad Institute RRID:SCR_017655 Prism v9 GraphPad https://www.graphpad.com/ scientific-software/prism/ Other Easy-nLC II system Thermo Fisher Scientific (Proxeon Biosystems) https://www.thermofisher.com/ LTQ Orbitrap Velos spectrometer Thermo Fisher Scientific https://www.thermofisher.com/ ChemiDoc MP imaging system Bio-Rad Cat# 12003154 LightCycler 480 system Roche https://diagnostics.roche.com/ global/en/products/systems/lightcycler480-system.html ..

    Indirect Immunoperoxidase Assay:

    Article Title: The mTOR chromatin-bound interactome in prostate cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER ON-TARGETplus SMARTpool non-targeting control siRNAs Dharmacon (Horizon Discovery) Cat# D-001810-10-20 Human shHDAC2#1: CAGTCTCACCAATTT CAGAAA Sigma-Aldrich Cat # TRCN0000004819 Human shHDAC2#2: GCCTATTATCTCAAA GGTGAT Sigma-Aldrich Cat# TRCN0000004821 Human gene-specific primers for qRT-PCR analysis This paper Table S7 Human gene-specific primers for ChIP-qPCR analysis This paper Table S7 Recombinant DNA ViraPowerTM Lentiviral Packaging Mix Thermo Fisher Scientific Cat# K4975-00 Lentiviral packaging plasmid psPAX2 addgene Cat# 12260 VSV-G envelope expressing plasmid pMD2.G addgene Cat# 12259 mTOR shRNA plasmid addgene Cat# 1856 Software and algorithms Proteome Discoverer v2.3 Thermo Scientific Cat# OPTON-20141 Mascot v2.6 Matrix Science http://www.matrixscience.com/ Scaffold v4.10.0 Proteome Software https://www.proteomesoftware.com/ Phantasus v1.11.0 Bioconductor (https://doi.org/ 10.18129/B9.bioc.phantasus) https://genome.ifmo.ru/phantasus ExPASy PeptideCutter Duvaud et al., 2021 https://web.expasy.org/peptide_cutter/ WebGestalt Liao et al., 2019 RRID:SCR_006786 Ingenuity Pathway Analysis (IPA) QIAGEN RRID:SCR_008653 Metascape Zhou et al., 2019 RRID:SCR_016620 Intervene Khan and Mathelier, 2017 https://asntech.shinyapps.io/intervene/ ChIP-Atlas Oki et al., 2018 RRID:SCR_015511 HOMER v4.11 Heinz et al., 2010 RRID:SCR_010881 BioGRID v3.5 Oughtred et al., 2019 RRID:SCR_007393 STRING v11.0 Szklarczyk et al., 2019 RRID:SCR_005223 HuRI Luck et al., 2020 RRID:SCR_015670 IID Kotlyar et al., 2016 http://ophid.utoronto.ca/iid Morpheus Broad Institute RRID:SCR_017386 Cancer Dependency Map (DepMap) portal Broad Institute RRID:SCR_017655 Prism v9 GraphPad https://www.graphpad.com/ scientific-software/prism/ Other Easy-nLC II system Thermo Fisher Scientific (Proxeon Biosystems) https://www.thermofisher.com/ LTQ Orbitrap Velos spectrometer Thermo Fisher Scientific https://www.thermofisher.com/ ChemiDoc MP imaging system Bio-Rad Cat# 12003154 LightCycler 480 system Roche https://diagnostics.roche.com/ global/en/products/systems/lightcycler480-system.html ..

    Chromatin Immunoprecipitation:

    Article Title: The mTOR chromatin-bound interactome in prostate cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER ON-TARGETplus SMARTpool non-targeting control siRNAs Dharmacon (Horizon Discovery) Cat# D-001810-10-20 Human shHDAC2#1: CAGTCTCACCAATTT CAGAAA Sigma-Aldrich Cat # TRCN0000004819 Human shHDAC2#2: GCCTATTATCTCAAA GGTGAT Sigma-Aldrich Cat# TRCN0000004821 Human gene-specific primers for qRT-PCR analysis This paper Table S7 Human gene-specific primers for ChIP-qPCR analysis This paper Table S7 Recombinant DNA ViraPowerTM Lentiviral Packaging Mix Thermo Fisher Scientific Cat# K4975-00 Lentiviral packaging plasmid psPAX2 addgene Cat# 12260 VSV-G envelope expressing plasmid pMD2.G addgene Cat# 12259 mTOR shRNA plasmid addgene Cat# 1856 Software and algorithms Proteome Discoverer v2.3 Thermo Scientific Cat# OPTON-20141 Mascot v2.6 Matrix Science http://www.matrixscience.com/ Scaffold v4.10.0 Proteome Software https://www.proteomesoftware.com/ Phantasus v1.11.0 Bioconductor (https://doi.org/ 10.18129/B9.bioc.phantasus) https://genome.ifmo.ru/phantasus ExPASy PeptideCutter Duvaud et al., 2021 https://web.expasy.org/peptide_cutter/ WebGestalt Liao et al., 2019 RRID:SCR_006786 Ingenuity Pathway Analysis (IPA) QIAGEN RRID:SCR_008653 Metascape Zhou et al., 2019 RRID:SCR_016620 Intervene Khan and Mathelier, 2017 https://asntech.shinyapps.io/intervene/ ChIP-Atlas Oki et al., 2018 RRID:SCR_015511 HOMER v4.11 Heinz et al., 2010 RRID:SCR_010881 BioGRID v3.5 Oughtred et al., 2019 RRID:SCR_007393 STRING v11.0 Szklarczyk et al., 2019 RRID:SCR_005223 HuRI Luck et al., 2020 RRID:SCR_015670 IID Kotlyar et al., 2016 http://ophid.utoronto.ca/iid Morpheus Broad Institute RRID:SCR_017386 Cancer Dependency Map (DepMap) portal Broad Institute RRID:SCR_017655 Prism v9 GraphPad https://www.graphpad.com/ scientific-software/prism/ Other Easy-nLC II system Thermo Fisher Scientific (Proxeon Biosystems) https://www.thermofisher.com/ LTQ Orbitrap Velos spectrometer Thermo Fisher Scientific https://www.thermofisher.com/ ChemiDoc MP imaging system Bio-Rad Cat# 12003154 LightCycler 480 system Roche https://diagnostics.roche.com/ global/en/products/systems/lightcycler480-system.html ..

    Imaging:

    Article Title: The mTOR chromatin-bound interactome in prostate cancer.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER ON-TARGETplus SMARTpool non-targeting control siRNAs Dharmacon (Horizon Discovery) Cat# D-001810-10-20 Human shHDAC2#1: CAGTCTCACCAATTT CAGAAA Sigma-Aldrich Cat # TRCN0000004819 Human shHDAC2#2: GCCTATTATCTCAAA GGTGAT Sigma-Aldrich Cat# TRCN0000004821 Human gene-specific primers for qRT-PCR analysis This paper Table S7 Human gene-specific primers for ChIP-qPCR analysis This paper Table S7 Recombinant DNA ViraPowerTM Lentiviral Packaging Mix Thermo Fisher Scientific Cat# K4975-00 Lentiviral packaging plasmid psPAX2 addgene Cat# 12260 VSV-G envelope expressing plasmid pMD2.G addgene Cat# 12259 mTOR shRNA plasmid addgene Cat# 1856 Software and algorithms Proteome Discoverer v2.3 Thermo Scientific Cat# OPTON-20141 Mascot v2.6 Matrix Science http://www.matrixscience.com/ Scaffold v4.10.0 Proteome Software https://www.proteomesoftware.com/ Phantasus v1.11.0 Bioconductor (https://doi.org/ 10.18129/B9.bioc.phantasus) https://genome.ifmo.ru/phantasus ExPASy PeptideCutter Duvaud et al., 2021 https://web.expasy.org/peptide_cutter/ WebGestalt Liao et al., 2019 RRID:SCR_006786 Ingenuity Pathway Analysis (IPA) QIAGEN RRID:SCR_008653 Metascape Zhou et al., 2019 RRID:SCR_016620 Intervene Khan and Mathelier, 2017 https://asntech.shinyapps.io/intervene/ ChIP-Atlas Oki et al., 2018 RRID:SCR_015511 HOMER v4.11 Heinz et al., 2010 RRID:SCR_010881 BioGRID v3.5 Oughtred et al., 2019 RRID:SCR_007393 STRING v11.0 Szklarczyk et al., 2019 RRID:SCR_005223 HuRI Luck et al., 2020 RRID:SCR_015670 IID Kotlyar et al., 2016 http://ophid.utoronto.ca/iid Morpheus Broad Institute RRID:SCR_017386 Cancer Dependency Map (DepMap) portal Broad Institute RRID:SCR_017655 Prism v9 GraphPad https://www.graphpad.com/ scientific-software/prism/ Other Easy-nLC II system Thermo Fisher Scientific (Proxeon Biosystems) https://www.thermofisher.com/ LTQ Orbitrap Velos spectrometer Thermo Fisher Scientific https://www.thermofisher.com/ ChemiDoc MP imaging system Bio-Rad Cat# 12003154 LightCycler 480 system Roche https://diagnostics.roche.com/ global/en/products/systems/lightcycler480-system.html ..



    Similar Products

    98
    Addgene inc mtor shrna plasmid addgene
    Figure 1. RIME identification of <t>mTOR</t> CIPs in PCa cells (A) Schematic of mTOR RIME analysis in four PCa models treated with vehicle (DMSO), the synthetic androgen R1881, and/or mTOR inhibitor Torin 1 in biological triplicates. Vehicle-treated immunoglobulin G controls were also used. (B) mTOR protein structure and cumulative peptide coverage from mTOR RIME analysis across triplicate experiments in four PCa cell lines. (C) Total mTOR RIME CIPs identified and whether they were previously known. (D) Immunoblot analysis of mTOR, AR full-length (AR-FL) and splice variant (AR-V7), and PTEN levels in nuclear PCa homogenates. Lamin B1 levels are shown as a loading control. (E) Overlap of mTOR RIME datasets between PCa cell lines/conditions. See also Figure S1.
    Mtor Shrna Plasmid Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mtor+shrna+plasmid+addgene/pMD2%2EG+(Plasmid+%2312259)/pm35320709-234-76-79
    Average 98 stars, based on 1 article reviews
    mtor shrna plasmid addgene - by Bioz Stars, 2026-09
    98/100 stars
      Buy from Supplier

    93
    Addgene inc mtor2 shrna addgene
    Figure 1. RIME identification of <t>mTOR</t> CIPs in PCa cells (A) Schematic of mTOR RIME analysis in four PCa models treated with vehicle (DMSO), the synthetic androgen R1881, and/or mTOR inhibitor Torin 1 in biological triplicates. Vehicle-treated immunoglobulin G controls were also used. (B) mTOR protein structure and cumulative peptide coverage from mTOR RIME analysis across triplicate experiments in four PCa cell lines. (C) Total mTOR RIME CIPs identified and whether they were previously known. (D) Immunoblot analysis of mTOR, AR full-length (AR-FL) and splice variant (AR-V7), and PTEN levels in nuclear PCa homogenates. Lamin B1 levels are shown as a loading control. (E) Overlap of mTOR RIME datasets between PCa cell lines/conditions. See also Figure S1.
    Mtor2 Shrna Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mtor+shrna+plasmid+addgene/mTOR_2+shRNA+(Plasmid+%231856)/pm34320351-241-231-233
    Average 93 stars, based on 1 article reviews
    mtor2 shrna addgene - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc rptor 2 shrna addgene
    Figure 1. RIME identification of <t>mTOR</t> CIPs in PCa cells (A) Schematic of mTOR RIME analysis in four PCa models treated with vehicle (DMSO), the synthetic androgen R1881, and/or mTOR inhibitor Torin 1 in biological triplicates. Vehicle-treated immunoglobulin G controls were also used. (B) mTOR protein structure and cumulative peptide coverage from mTOR RIME analysis across triplicate experiments in four PCa cell lines. (C) Total mTOR RIME CIPs identified and whether they were previously known. (D) Immunoblot analysis of mTOR, AR full-length (AR-FL) and splice variant (AR-V7), and PTEN levels in nuclear PCa homogenates. Lamin B1 levels are shown as a loading control. (E) Overlap of mTOR RIME datasets between PCa cell lines/conditions. See also Figure S1.
    Rptor 2 Shrna Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mtor+shrna+plasmid+addgene/mTOR_2+shRNA+(Plasmid+%231856)/pm34320351-241-222-225
    Average 93 stars, based on 1 article reviews
    rptor 2 shrna addgene - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc rptor 1 shrna addgene
    Figure 1. RIME identification of <t>mTOR</t> CIPs in PCa cells (A) Schematic of mTOR RIME analysis in four PCa models treated with vehicle (DMSO), the synthetic androgen R1881, and/or mTOR inhibitor Torin 1 in biological triplicates. Vehicle-treated immunoglobulin G controls were also used. (B) mTOR protein structure and cumulative peptide coverage from mTOR RIME analysis across triplicate experiments in four PCa cell lines. (C) Total mTOR RIME CIPs identified and whether they were previously known. (D) Immunoblot analysis of mTOR, AR full-length (AR-FL) and splice variant (AR-V7), and PTEN levels in nuclear PCa homogenates. Lamin B1 levels are shown as a loading control. (E) Overlap of mTOR RIME datasets between PCa cell lines/conditions. See also Figure S1.
    Rptor 1 Shrna Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mtor+shrna+plasmid+addgene/mTOR_1+shRNA+(Plasmid+%231855)/pm34320351-241-217-220
    Average 93 stars, based on 1 article reviews
    rptor 1 shrna addgene - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc mtor1 shrna addgene
    Figure 1. RIME identification of <t>mTOR</t> CIPs in PCa cells (A) Schematic of mTOR RIME analysis in four PCa models treated with vehicle (DMSO), the synthetic androgen R1881, and/or mTOR inhibitor Torin 1 in biological triplicates. Vehicle-treated immunoglobulin G controls were also used. (B) mTOR protein structure and cumulative peptide coverage from mTOR RIME analysis across triplicate experiments in four PCa cell lines. (C) Total mTOR RIME CIPs identified and whether they were previously known. (D) Immunoblot analysis of mTOR, AR full-length (AR-FL) and splice variant (AR-V7), and PTEN levels in nuclear PCa homogenates. Lamin B1 levels are shown as a loading control. (E) Overlap of mTOR RIME datasets between PCa cell lines/conditions. See also Figure S1.
    Mtor1 Shrna Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mtor+shrna+plasmid+addgene/mTOR_1+shRNA+(Plasmid+%231855)/pm34320351-241-227-229
    Average 93 stars, based on 1 article reviews
    mtor1 shrna addgene - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc ccgcattgtctctatcaagtt human mtor 2 addgene
    Figure 1. RIME identification of <t>mTOR</t> CIPs in PCa cells (A) Schematic of mTOR RIME analysis in four PCa models treated with vehicle (DMSO), the synthetic androgen R1881, and/or mTOR inhibitor Torin 1 in biological triplicates. Vehicle-treated immunoglobulin G controls were also used. (B) mTOR protein structure and cumulative peptide coverage from mTOR RIME analysis across triplicate experiments in four PCa cell lines. (C) Total mTOR RIME CIPs identified and whether they were previously known. (D) Immunoblot analysis of mTOR, AR full-length (AR-FL) and splice variant (AR-V7), and PTEN levels in nuclear PCa homogenates. Lamin B1 levels are shown as a loading control. (E) Overlap of mTOR RIME datasets between PCa cell lines/conditions. See also Figure S1.
    Ccgcattgtctctatcaagtt Human Mtor 2 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mtor+shrna+plasmid+addgene/mTOR_1+shRNA+(Plasmid+%231855)/pmc06717289__pnas__1901765116__sapp-192-175-179
    Average 93 stars, based on 1 article reviews
    ccgcattgtctctatcaagtt human mtor 2 addgene - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc ggctagtctgtttcgaaattt human mtor 1 addgene
    Figure 1. RIME identification of <t>mTOR</t> CIPs in PCa cells (A) Schematic of mTOR RIME analysis in four PCa models treated with vehicle (DMSO), the synthetic androgen R1881, and/or mTOR inhibitor Torin 1 in biological triplicates. Vehicle-treated immunoglobulin G controls were also used. (B) mTOR protein structure and cumulative peptide coverage from mTOR RIME analysis across triplicate experiments in four PCa cell lines. (C) Total mTOR RIME CIPs identified and whether they were previously known. (D) Immunoblot analysis of mTOR, AR full-length (AR-FL) and splice variant (AR-V7), and PTEN levels in nuclear PCa homogenates. Lamin B1 levels are shown as a loading control. (E) Overlap of mTOR RIME datasets between PCa cell lines/conditions. See also Figure S1.
    Ggctagtctgtttcgaaattt Human Mtor 1 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mtor+shrna+plasmid+addgene/Raptor_2+shRNA+(Plasmid+%231858)/pmc06717289__pnas__1901765116__sapp-192-169-173
    Average 93 stars, based on 1 article reviews
    ggctagtctgtttcgaaattt human mtor 1 addgene - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    93
    Addgene inc ttcagcgtccctaccttcttct mouse rictor 1 addgene
    Figure 1. RIME identification of <t>mTOR</t> CIPs in PCa cells (A) Schematic of mTOR RIME analysis in four PCa models treated with vehicle (DMSO), the synthetic androgen R1881, and/or mTOR inhibitor Torin 1 in biological triplicates. Vehicle-treated immunoglobulin G controls were also used. (B) mTOR protein structure and cumulative peptide coverage from mTOR RIME analysis across triplicate experiments in four PCa cell lines. (C) Total mTOR RIME CIPs identified and whether they were previously known. (D) Immunoblot analysis of mTOR, AR full-length (AR-FL) and splice variant (AR-V7), and PTEN levels in nuclear PCa homogenates. Lamin B1 levels are shown as a loading control. (E) Overlap of mTOR RIME datasets between PCa cell lines/conditions. See also Figure S1.
    Ttcagcgtccctaccttcttct Mouse Rictor 1 Addgene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mtor+shrna+plasmid+addgene/mTOR_2+shRNA+(Plasmid+%231856)/pmc06717289__pnas__1901765116__sapp-192-181-185
    Average 93 stars, based on 1 article reviews
    ttcagcgtccctaccttcttct mouse rictor 1 addgene - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results


    Figure 1. RIME identification of mTOR CIPs in PCa cells (A) Schematic of mTOR RIME analysis in four PCa models treated with vehicle (DMSO), the synthetic androgen R1881, and/or mTOR inhibitor Torin 1 in biological triplicates. Vehicle-treated immunoglobulin G controls were also used. (B) mTOR protein structure and cumulative peptide coverage from mTOR RIME analysis across triplicate experiments in four PCa cell lines. (C) Total mTOR RIME CIPs identified and whether they were previously known. (D) Immunoblot analysis of mTOR, AR full-length (AR-FL) and splice variant (AR-V7), and PTEN levels in nuclear PCa homogenates. Lamin B1 levels are shown as a loading control. (E) Overlap of mTOR RIME datasets between PCa cell lines/conditions. See also Figure S1.

    Journal: Cell reports

    Article Title: The mTOR chromatin-bound interactome in prostate cancer.

    doi: 10.1016/j.celrep.2022.110534

    Figure Lengend Snippet: Figure 1. RIME identification of mTOR CIPs in PCa cells (A) Schematic of mTOR RIME analysis in four PCa models treated with vehicle (DMSO), the synthetic androgen R1881, and/or mTOR inhibitor Torin 1 in biological triplicates. Vehicle-treated immunoglobulin G controls were also used. (B) mTOR protein structure and cumulative peptide coverage from mTOR RIME analysis across triplicate experiments in four PCa cell lines. (C) Total mTOR RIME CIPs identified and whether they were previously known. (D) Immunoblot analysis of mTOR, AR full-length (AR-FL) and splice variant (AR-V7), and PTEN levels in nuclear PCa homogenates. Lamin B1 levels are shown as a loading control. (E) Overlap of mTOR RIME datasets between PCa cell lines/conditions. See also Figure S1.

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER ON-TARGETplus SMARTpool non-targeting control siRNAs Dharmacon (Horizon Discovery) Cat# D-001810-10-20 Human shHDAC2#1: CAGTCTCACCAATTT CAGAAA Sigma-Aldrich Cat # TRCN0000004819 Human shHDAC2#2: GCCTATTATCTCAAA GGTGAT Sigma-Aldrich Cat# TRCN0000004821 Human gene-specific primers for qRT-PCR analysis This paper Table S7 Human gene-specific primers for ChIP-qPCR analysis This paper Table S7 Recombinant DNA ViraPowerTM Lentiviral Packaging Mix Thermo Fisher Scientific Cat# K4975-00 Lentiviral packaging plasmid psPAX2 addgene Cat# 12260 VSV-G envelope expressing plasmid pMD2.G addgene Cat# 12259 mTOR shRNA plasmid addgene Cat# 1856 Software and algorithms Proteome Discoverer v2.3 Thermo Scientific Cat# OPTON-20141 Mascot v2.6 Matrix Science http://www.matrixscience.com/ Scaffold v4.10.0 Proteome Software https://www.proteomesoftware.com/ Phantasus v1.11.0 Bioconductor (https://doi.org/ 10.18129/B9.bioc.phantasus) https://genome.ifmo.ru/phantasus ExPASy PeptideCutter Duvaud et al., 2021 https://web.expasy.org/peptide_cutter/ WebGestalt Liao et al., 2019 RRID:SCR_006786 Ingenuity Pathway Analysis (IPA) QIAGEN RRID:SCR_008653 Metascape Zhou et al., 2019 RRID:SCR_016620 Intervene Khan and Mathelier, 2017 https://asntech.shinyapps.io/intervene/ ChIP-Atlas Oki et al., 2018 RRID:SCR_015511 HOMER v4.11 Heinz et al., 2010 RRID:SCR_010881 BioGRID v3.5 Oughtred et al., 2019 RRID:SCR_007393 STRING v11.0 Szklarczyk et al., 2019 RRID:SCR_005223 HuRI Luck et al., 2020 RRID:SCR_015670 IID Kotlyar et al., 2016 http://ophid.utoronto.ca/iid Morpheus Broad Institute RRID:SCR_017386 Cancer Dependency Map (DepMap) portal Broad Institute RRID:SCR_017655 Prism v9 GraphPad https://www.graphpad.com/ scientific-software/prism/ Other Easy-nLC II system Thermo Fisher Scientific (Proxeon Biosystems) https://www.thermofisher.com/ LTQ Orbitrap Velos spectrometer Thermo Fisher Scientific https://www.thermofisher.com/ ChemiDoc MP imaging system Bio-Rad Cat# 12003154 LightCycler 480 system Roche https://diagnostics.roche.com/ global/en/products/systems/lightcycler480-system.html

    Techniques: Western Blot, Variant Assay, Control

    Figure 2. Effect of R1881 and/or Torin 1 on chromatin mTOR-protein interactions (A) Overlap of drug-modulated mTOR CIPs from triplicate RIME experiments in AR+ LNCaP and 22Rv1 cells. (B) R1881-modulated chromatin-bound mTOR-protein affinities. Gene names for a subset of the CIPs are shown. Red, enhanced/gained interactions; blue, reduced/lost interactions. (C) AR protein structure and cumulative peptide coverage from mTOR RIME analysis across triplicate experiments in AR+ cells.

    Journal: Cell reports

    Article Title: The mTOR chromatin-bound interactome in prostate cancer.

    doi: 10.1016/j.celrep.2022.110534

    Figure Lengend Snippet: Figure 2. Effect of R1881 and/or Torin 1 on chromatin mTOR-protein interactions (A) Overlap of drug-modulated mTOR CIPs from triplicate RIME experiments in AR+ LNCaP and 22Rv1 cells. (B) R1881-modulated chromatin-bound mTOR-protein affinities. Gene names for a subset of the CIPs are shown. Red, enhanced/gained interactions; blue, reduced/lost interactions. (C) AR protein structure and cumulative peptide coverage from mTOR RIME analysis across triplicate experiments in AR+ cells.

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER ON-TARGETplus SMARTpool non-targeting control siRNAs Dharmacon (Horizon Discovery) Cat# D-001810-10-20 Human shHDAC2#1: CAGTCTCACCAATTT CAGAAA Sigma-Aldrich Cat # TRCN0000004819 Human shHDAC2#2: GCCTATTATCTCAAA GGTGAT Sigma-Aldrich Cat# TRCN0000004821 Human gene-specific primers for qRT-PCR analysis This paper Table S7 Human gene-specific primers for ChIP-qPCR analysis This paper Table S7 Recombinant DNA ViraPowerTM Lentiviral Packaging Mix Thermo Fisher Scientific Cat# K4975-00 Lentiviral packaging plasmid psPAX2 addgene Cat# 12260 VSV-G envelope expressing plasmid pMD2.G addgene Cat# 12259 mTOR shRNA plasmid addgene Cat# 1856 Software and algorithms Proteome Discoverer v2.3 Thermo Scientific Cat# OPTON-20141 Mascot v2.6 Matrix Science http://www.matrixscience.com/ Scaffold v4.10.0 Proteome Software https://www.proteomesoftware.com/ Phantasus v1.11.0 Bioconductor (https://doi.org/ 10.18129/B9.bioc.phantasus) https://genome.ifmo.ru/phantasus ExPASy PeptideCutter Duvaud et al., 2021 https://web.expasy.org/peptide_cutter/ WebGestalt Liao et al., 2019 RRID:SCR_006786 Ingenuity Pathway Analysis (IPA) QIAGEN RRID:SCR_008653 Metascape Zhou et al., 2019 RRID:SCR_016620 Intervene Khan and Mathelier, 2017 https://asntech.shinyapps.io/intervene/ ChIP-Atlas Oki et al., 2018 RRID:SCR_015511 HOMER v4.11 Heinz et al., 2010 RRID:SCR_010881 BioGRID v3.5 Oughtred et al., 2019 RRID:SCR_007393 STRING v11.0 Szklarczyk et al., 2019 RRID:SCR_005223 HuRI Luck et al., 2020 RRID:SCR_015670 IID Kotlyar et al., 2016 http://ophid.utoronto.ca/iid Morpheus Broad Institute RRID:SCR_017386 Cancer Dependency Map (DepMap) portal Broad Institute RRID:SCR_017655 Prism v9 GraphPad https://www.graphpad.com/ scientific-software/prism/ Other Easy-nLC II system Thermo Fisher Scientific (Proxeon Biosystems) https://www.thermofisher.com/ LTQ Orbitrap Velos spectrometer Thermo Fisher Scientific https://www.thermofisher.com/ ChemiDoc MP imaging system Bio-Rad Cat# 12003154 LightCycler 480 system Roche https://diagnostics.roche.com/ global/en/products/systems/lightcycler480-system.html

    Techniques:

    Figure 3. Functional enrichment analysis of mTOR CIPs in LNCaP cells ± R1881 (A) Venn diagrams showing the number of mTOR CIPs identified in LNCaP cells from biological triplicates under vehicle or R1881 conditions versus immuno- globulin G control with 87% of the total having a known nuclear localization.

    Journal: Cell reports

    Article Title: The mTOR chromatin-bound interactome in prostate cancer.

    doi: 10.1016/j.celrep.2022.110534

    Figure Lengend Snippet: Figure 3. Functional enrichment analysis of mTOR CIPs in LNCaP cells ± R1881 (A) Venn diagrams showing the number of mTOR CIPs identified in LNCaP cells from biological triplicates under vehicle or R1881 conditions versus immuno- globulin G control with 87% of the total having a known nuclear localization.

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER ON-TARGETplus SMARTpool non-targeting control siRNAs Dharmacon (Horizon Discovery) Cat# D-001810-10-20 Human shHDAC2#1: CAGTCTCACCAATTT CAGAAA Sigma-Aldrich Cat # TRCN0000004819 Human shHDAC2#2: GCCTATTATCTCAAA GGTGAT Sigma-Aldrich Cat# TRCN0000004821 Human gene-specific primers for qRT-PCR analysis This paper Table S7 Human gene-specific primers for ChIP-qPCR analysis This paper Table S7 Recombinant DNA ViraPowerTM Lentiviral Packaging Mix Thermo Fisher Scientific Cat# K4975-00 Lentiviral packaging plasmid psPAX2 addgene Cat# 12260 VSV-G envelope expressing plasmid pMD2.G addgene Cat# 12259 mTOR shRNA plasmid addgene Cat# 1856 Software and algorithms Proteome Discoverer v2.3 Thermo Scientific Cat# OPTON-20141 Mascot v2.6 Matrix Science http://www.matrixscience.com/ Scaffold v4.10.0 Proteome Software https://www.proteomesoftware.com/ Phantasus v1.11.0 Bioconductor (https://doi.org/ 10.18129/B9.bioc.phantasus) https://genome.ifmo.ru/phantasus ExPASy PeptideCutter Duvaud et al., 2021 https://web.expasy.org/peptide_cutter/ WebGestalt Liao et al., 2019 RRID:SCR_006786 Ingenuity Pathway Analysis (IPA) QIAGEN RRID:SCR_008653 Metascape Zhou et al., 2019 RRID:SCR_016620 Intervene Khan and Mathelier, 2017 https://asntech.shinyapps.io/intervene/ ChIP-Atlas Oki et al., 2018 RRID:SCR_015511 HOMER v4.11 Heinz et al., 2010 RRID:SCR_010881 BioGRID v3.5 Oughtred et al., 2019 RRID:SCR_007393 STRING v11.0 Szklarczyk et al., 2019 RRID:SCR_005223 HuRI Luck et al., 2020 RRID:SCR_015670 IID Kotlyar et al., 2016 http://ophid.utoronto.ca/iid Morpheus Broad Institute RRID:SCR_017386 Cancer Dependency Map (DepMap) portal Broad Institute RRID:SCR_017655 Prism v9 GraphPad https://www.graphpad.com/ scientific-software/prism/ Other Easy-nLC II system Thermo Fisher Scientific (Proxeon Biosystems) https://www.thermofisher.com/ LTQ Orbitrap Velos spectrometer Thermo Fisher Scientific https://www.thermofisher.com/ ChemiDoc MP imaging system Bio-Rad Cat# 12003154 LightCycler 480 system Roche https://diagnostics.roche.com/ global/en/products/systems/lightcycler480-system.html

    Techniques: Functional Assay, Control

    Figure 4. Identification of a conserved mTOR chromatin network in PCa cells (A) Left, common significantly over-represented Ingenuity Pathway Analysis (IPA) canonical pathways from mTOR RIME analysis in four PCa cell lines under basal conditions (vehicle-treated) performed in biological triplicates. Right, mTOR RIME associations with NuRD complex components. (B) Chow-Ruskey Venn diagram of mTOR RIME datasets from four PCa cell lines in the basal state (vehicle-treated) shows a conserved set of 67 mTOR CIPs. (C) Basic functional annotation of the conserved mTOR 67-CIP hub identified in (B). (D) Metascape interactome network of the conserved mTOR 67-CIP set identified in (B) along with four extracted MCODE subcomplexes and their associated biological functions. Larger node size reflects increased protein interconnectivity. (E) Ranked normalized TPIs of identified mTOR RIME CIPs in four PCa cell lines from triplicate experiments of vehicle-treated versus immunoglobulin G control showing SUMO2 and SUMO3 as top conserved hits. See also Figures S3 and S4.

    Journal: Cell reports

    Article Title: The mTOR chromatin-bound interactome in prostate cancer.

    doi: 10.1016/j.celrep.2022.110534

    Figure Lengend Snippet: Figure 4. Identification of a conserved mTOR chromatin network in PCa cells (A) Left, common significantly over-represented Ingenuity Pathway Analysis (IPA) canonical pathways from mTOR RIME analysis in four PCa cell lines under basal conditions (vehicle-treated) performed in biological triplicates. Right, mTOR RIME associations with NuRD complex components. (B) Chow-Ruskey Venn diagram of mTOR RIME datasets from four PCa cell lines in the basal state (vehicle-treated) shows a conserved set of 67 mTOR CIPs. (C) Basic functional annotation of the conserved mTOR 67-CIP hub identified in (B). (D) Metascape interactome network of the conserved mTOR 67-CIP set identified in (B) along with four extracted MCODE subcomplexes and their associated biological functions. Larger node size reflects increased protein interconnectivity. (E) Ranked normalized TPIs of identified mTOR RIME CIPs in four PCa cell lines from triplicate experiments of vehicle-treated versus immunoglobulin G control showing SUMO2 and SUMO3 as top conserved hits. See also Figures S3 and S4.

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER ON-TARGETplus SMARTpool non-targeting control siRNAs Dharmacon (Horizon Discovery) Cat# D-001810-10-20 Human shHDAC2#1: CAGTCTCACCAATTT CAGAAA Sigma-Aldrich Cat # TRCN0000004819 Human shHDAC2#2: GCCTATTATCTCAAA GGTGAT Sigma-Aldrich Cat# TRCN0000004821 Human gene-specific primers for qRT-PCR analysis This paper Table S7 Human gene-specific primers for ChIP-qPCR analysis This paper Table S7 Recombinant DNA ViraPowerTM Lentiviral Packaging Mix Thermo Fisher Scientific Cat# K4975-00 Lentiviral packaging plasmid psPAX2 addgene Cat# 12260 VSV-G envelope expressing plasmid pMD2.G addgene Cat# 12259 mTOR shRNA plasmid addgene Cat# 1856 Software and algorithms Proteome Discoverer v2.3 Thermo Scientific Cat# OPTON-20141 Mascot v2.6 Matrix Science http://www.matrixscience.com/ Scaffold v4.10.0 Proteome Software https://www.proteomesoftware.com/ Phantasus v1.11.0 Bioconductor (https://doi.org/ 10.18129/B9.bioc.phantasus) https://genome.ifmo.ru/phantasus ExPASy PeptideCutter Duvaud et al., 2021 https://web.expasy.org/peptide_cutter/ WebGestalt Liao et al., 2019 RRID:SCR_006786 Ingenuity Pathway Analysis (IPA) QIAGEN RRID:SCR_008653 Metascape Zhou et al., 2019 RRID:SCR_016620 Intervene Khan and Mathelier, 2017 https://asntech.shinyapps.io/intervene/ ChIP-Atlas Oki et al., 2018 RRID:SCR_015511 HOMER v4.11 Heinz et al., 2010 RRID:SCR_010881 BioGRID v3.5 Oughtred et al., 2019 RRID:SCR_007393 STRING v11.0 Szklarczyk et al., 2019 RRID:SCR_005223 HuRI Luck et al., 2020 RRID:SCR_015670 IID Kotlyar et al., 2016 http://ophid.utoronto.ca/iid Morpheus Broad Institute RRID:SCR_017386 Cancer Dependency Map (DepMap) portal Broad Institute RRID:SCR_017655 Prism v9 GraphPad https://www.graphpad.com/ scientific-software/prism/ Other Easy-nLC II system Thermo Fisher Scientific (Proxeon Biosystems) https://www.thermofisher.com/ LTQ Orbitrap Velos spectrometer Thermo Fisher Scientific https://www.thermofisher.com/ ChemiDoc MP imaging system Bio-Rad Cat# 12003154 LightCycler 480 system Roche https://diagnostics.roche.com/ global/en/products/systems/lightcycler480-system.html

    Techniques: Functional Assay, Control

    Figure 7. Androgens promote assembly of an mTOR-AR-HDAC2 transcriptional complex (A) Co-IP experiments in LNCaP cells show that mTOR and AR interact with NuRD complex components. (B) R1881 increases the overlap of mTOR, AR, and HDAC2 ChIP-seq peaks in PCa cells. (C) Genome-wide mapping of mTOR-AR-HDAC2 co-occupied sites between vehicle (EtOH)- and R1881-treated PCa cells. (D) Pie charts showing that most of the mTOR-AR-HDAC2 peaks found within ±20 kb of ARG TSSs are up-regulated by androgens. (E) Genome browser views showing R1881-mediated de novo formation of an mTOR-AR-HDAC2 complex at ARGs in PCa cells. (F) Heatmaps of ChIP-qPCR enrichment values in LNCaP cells showing the temporal R1881-mediated co-recruitment of mTOR, AR, NuRD-associated HDAC2 and CHD4, RNA polymerase II, and deposition of the active histone mark H3K27ac at mTOR-AR-HDAC2-targeted ARGs shown in (E). (G) Immunoblots showing efficacy of shRNA-mediated silencing of HDAC2 in LNCaP cells. Lamin B1 levels are shown as a loading control.

    Journal: Cell reports

    Article Title: The mTOR chromatin-bound interactome in prostate cancer.

    doi: 10.1016/j.celrep.2022.110534

    Figure Lengend Snippet: Figure 7. Androgens promote assembly of an mTOR-AR-HDAC2 transcriptional complex (A) Co-IP experiments in LNCaP cells show that mTOR and AR interact with NuRD complex components. (B) R1881 increases the overlap of mTOR, AR, and HDAC2 ChIP-seq peaks in PCa cells. (C) Genome-wide mapping of mTOR-AR-HDAC2 co-occupied sites between vehicle (EtOH)- and R1881-treated PCa cells. (D) Pie charts showing that most of the mTOR-AR-HDAC2 peaks found within ±20 kb of ARG TSSs are up-regulated by androgens. (E) Genome browser views showing R1881-mediated de novo formation of an mTOR-AR-HDAC2 complex at ARGs in PCa cells. (F) Heatmaps of ChIP-qPCR enrichment values in LNCaP cells showing the temporal R1881-mediated co-recruitment of mTOR, AR, NuRD-associated HDAC2 and CHD4, RNA polymerase II, and deposition of the active histone mark H3K27ac at mTOR-AR-HDAC2-targeted ARGs shown in (E). (G) Immunoblots showing efficacy of shRNA-mediated silencing of HDAC2 in LNCaP cells. Lamin B1 levels are shown as a loading control.

    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER ON-TARGETplus SMARTpool non-targeting control siRNAs Dharmacon (Horizon Discovery) Cat# D-001810-10-20 Human shHDAC2#1: CAGTCTCACCAATTT CAGAAA Sigma-Aldrich Cat # TRCN0000004819 Human shHDAC2#2: GCCTATTATCTCAAA GGTGAT Sigma-Aldrich Cat# TRCN0000004821 Human gene-specific primers for qRT-PCR analysis This paper Table S7 Human gene-specific primers for ChIP-qPCR analysis This paper Table S7 Recombinant DNA ViraPowerTM Lentiviral Packaging Mix Thermo Fisher Scientific Cat# K4975-00 Lentiviral packaging plasmid psPAX2 addgene Cat# 12260 VSV-G envelope expressing plasmid pMD2.G addgene Cat# 12259 mTOR shRNA plasmid addgene Cat# 1856 Software and algorithms Proteome Discoverer v2.3 Thermo Scientific Cat# OPTON-20141 Mascot v2.6 Matrix Science http://www.matrixscience.com/ Scaffold v4.10.0 Proteome Software https://www.proteomesoftware.com/ Phantasus v1.11.0 Bioconductor (https://doi.org/ 10.18129/B9.bioc.phantasus) https://genome.ifmo.ru/phantasus ExPASy PeptideCutter Duvaud et al., 2021 https://web.expasy.org/peptide_cutter/ WebGestalt Liao et al., 2019 RRID:SCR_006786 Ingenuity Pathway Analysis (IPA) QIAGEN RRID:SCR_008653 Metascape Zhou et al., 2019 RRID:SCR_016620 Intervene Khan and Mathelier, 2017 https://asntech.shinyapps.io/intervene/ ChIP-Atlas Oki et al., 2018 RRID:SCR_015511 HOMER v4.11 Heinz et al., 2010 RRID:SCR_010881 BioGRID v3.5 Oughtred et al., 2019 RRID:SCR_007393 STRING v11.0 Szklarczyk et al., 2019 RRID:SCR_005223 HuRI Luck et al., 2020 RRID:SCR_015670 IID Kotlyar et al., 2016 http://ophid.utoronto.ca/iid Morpheus Broad Institute RRID:SCR_017386 Cancer Dependency Map (DepMap) portal Broad Institute RRID:SCR_017655 Prism v9 GraphPad https://www.graphpad.com/ scientific-software/prism/ Other Easy-nLC II system Thermo Fisher Scientific (Proxeon Biosystems) https://www.thermofisher.com/ LTQ Orbitrap Velos spectrometer Thermo Fisher Scientific https://www.thermofisher.com/ ChemiDoc MP imaging system Bio-Rad Cat# 12003154 LightCycler 480 system Roche https://diagnostics.roche.com/ global/en/products/systems/lightcycler480-system.html

    Techniques: Co-Immunoprecipitation Assay, ChIP-sequencing, Genome Wide, ChIP-qPCR, Western Blot, shRNA, Control